Y-DNA

 

Y-DNA kan kun testes af mænd,

arves kun fra den fædrene linie og går langt tilbage i tiden

 

Ud over autosomale kromosomer, så findes der også et kønskromosom-par. Hvis dette par består af et X- og et Y-kromosom, så er man genetisk set mand. Hvis parret består af 2 X-kromosomer, så er man genetisk set kvinde. Altså kan analyser af Y-kromosomet kun gøres for mænd.

 

En mand har altid arvet sit Y-kromosom fra sin far, der har fået det fra sin far osv. På denne måde rækker analyser af Y-kromosomet langt tilbage i tiden ad den fædrene linie.

 

Som udgangspunkt nedarves Y-kromosomet udforandret. Men indimellem sker der kopieringsfejl (kaldet mutationer), og dermed gives en lidt forandret version af Y-kromosomet videre. På den måde skabes en ny gren af menneskehedens "mandlige stamtræ", en ny såkaldt haplogruppe. Der findes til stadighed nye haplogrupper.

 

Hvilke resultater får jeg fra en Y-DNA-test?

 

Hvert selskab analyserer dit Y-DNA for mutationer. Ud fra disse kan du placeres ind i din haplogruppe, altså din gren af menneskehedens "mandlige stamtræ".

 

Den haplogruppe, som du får tildelt, er ofte hundredevis eller tusindvis af år gammel. Men der sker relativt hyppigt mutationer af Y-kromosomet. Derfor tilhører du sandsynligvis en meget yngre og mere præcis haplogruppe, som du kan være med til at opdage gennem videre testning.

I takt med at flere og flere tester sig, så vil det i stigende grad være muligt også at finde slægtsforbindelser via Y-DNA.

 

Når du kender din haplogruppe, så kan du søge information om, hvilke befolkningsgrupper denne typisk indgår i, hvilken vandring over jordkloden din fædrene linie ser ud til at have gjort osv.

 

FamilyTreeDNA har en database med personer, som har taget samme test. Du får derfor en liste over personer i databasen, som du deler Y-DNA med, altså en liste over personer, som du "matcher". Disse personer må på et tidspunkt tilbage i historien stamme fra samme mand som dig - gennem jeres begges fædrene linier. Men forbindelsen kan ligge langt tilbage i tiden.

 

Man behøver ikke at forstå enkelthederne i analyserne for at teste sig. Men som baggrundsinformation kan oplyses, at der findes to forskellige typer af mutationer, som Y-DNA-analyserne bygger på:

- Short tandem repeats (STRs), dvs. steder på kromosomet, hvor en DNA-kombination gentages et vist antal gange. Stederne med STR'er har hver deres navn, og resultatet er et tal, der angiver antallet af gentagelser. Eksempelvis vil resultatet for ACTACTACTACTACTACTACTACT være 8.

- Single-nucleotide polymorphisms (SNPs, udtales "snips"), dvs. steder på kromosomet, hvor én byggesten er udskiftet med en anden byggesten. Eksempelvis kan C være udskiftet med G. Når man opdager sådan en mutation, så får den også et navn.

 

Hvem skal jeg teste?

 

Som mand kan man teste sig selv. Ens (biologiske) far har næsten eller helt identisk Y-DNA med en selv. Om man vælger at teste sin far i stedet gør altså oftest ikke den store forskel.

Som kvinde kan man ikke teste sig selv, men i stedet f.eks. sin far eller bror (med samme far).

 

Man kan desuden overveje, om der i familien er en særligt interessant fædrene linie. Hvis ens morfars fædrene linie er spændende, så kan man eksempelvis teste ham, en af hans brødre (med samme far) eller en af hans sønner - afhængigt af hvem det er muligt at teste.

 

Y-DNA er velegnet til at forsøge at finde ud af, om de officielle fædre i en given linie også rent faktisk var de biologiske fædre. Y-DNA er også velegnet til at undersøge, om en fædrene linie falder sammen en anden mands fædrene linie for flere hundrede år siden.

I begge situationer skal man teste to eller flere nulevende mænd i den direkte fædrene linie. Det er ikke altid, at man får et helt éntydigt svar, men ofte er det rigtigt brugbart. Studier tyder i retning af, at der historisk set ved 1-2% af fødsler er en anden biologisk far end den officielle. Man må altså gå ud fra, at alle i et eller andet omfang har "forkerte" forfædre i anetavlen - men dog ikke i så stort et omfang.

 

Hvilke selskaber tilbyder test af Y-DNA?

 

Det gør FamilyTreeDNA, YSEQ, Full Genomes og til dels 23andMe.

FamilyTreeDNA er absolut det væsentligste selskab indenfor Y-DNA.